Tag Archives: genome

Benny and the Genes

By Stacie Robinson What does “aaaaaaaaaaggaattgtgaagactatat” mean to you? To the scientists of NOAA’s Hawaiian Monk Seal Research Program, it means the beginning of  a new era of conservation research that will help them better understand this unique Hawaiian species … Continue reading

Posted in Protected Species | Tagged , , , , , , ,