Benny and the Genes

By Stacie Robinson

What does “aaaaaaaaaaggaattgtgaagactatat” mean to you?

To the scientists of NOAA’s Hawaiian Monk Seal Research Program, it means the beginning of  a new era of conservation research that will help them better understand this unique Hawaiian species and aid in its recovery.  C, g, t, and a are the basic components of DNA, and that string represents the first tiny bit of the recently-sequenced Hawaiian monk seal genome.  Think of it as the first words of the book-of-the-monk-seal being translated for the first time.

This image shows just the beginning of the first full genome sequence of a Hawaiian monk seal. Now posted on NCBI Genbank at https://www.ncbi.nlm.nih.gov/genome/annotation_euk/Neomonachus_schauinslandi/100/.

What does a genome sequence mean to monk seals?

A lot!  A species genome is basically an organism’s complete set of genetic instructions.  It contains all of the information needed to build and maintain that organism.

With just 1,400 animals left, the Hawaiian monk seal is one of the world’s most endangered marine mammals.  To help recover the monk seal population, it’s important for scientists to understand its long-term evolutionary history as well as its current structure, health issues, and breeding biology.  Because monk seals have had a long history of population ups and downs, they are left with low genetic diversity.  So, classical genetics methods often yield inconclusive results.  The full genome sequence gives greater resolution to develop new tools and answer more questions.

A young Hawaiian monk seal swims along the reef.

The monk seal genome sequence will no doubt lead to greater understanding of the evolution of the world’s only tropical true seal.  It will help reveal the relationships between individuals to understand the population’s pedigree (how each seal is related to every other seal) and breeding biology.  It will lead to better understanding of variation throughout the population and localized adaptations for specific environments.  It will even help identify genetic factors associated with disease susceptibility or other health issues.

A mother monk seal basks on the sand with her pup. Genomics data will help to study familial relationships, pedigrees, and much more.

Who’s genome is it?

The first monk seal whose genome was sequenced was RE74, popularly known as “Benny,” a fifteen year old male who frequents beaches on Oahu’s west side.  As 1 of just about 300 animals in the main Hawaiian Islands, Benny represents the hopeful future of this species making a comeback and coexisting with the growing human population on the islands.  But, Benny also represents the challenges of coexistence: he has had several encounters with fishing gear, twice requiring open-gut surgery to remove large hooks.  The one upside to Benny’s frequent captures and veterinary treatments is that geneticistshad plenty of opportunities to get fresh blood samples!  Maybe they’ll even find the gene that codes for the dangerous love of fish hooks! (OK – probably not, that’s almost certainly a very complex trait from just as much nurture as nature!)

This is Benny (RE74), just before release with a satellite tracking tag after he’d undergone surgery to remove a fish hook. While he was being treated, several samples were collected – some of which led to the first monk seal genome sequence.

What made it possible? 

Collaboration! Technology!  The monk seal genome was sequenced and annotated by Drs. Alan Scott and David Mohr and their collaborators at Johns Hopkins University and partnering companies.  While you may have heard about the many years and many millions of dollars involved in The Human Genome Project, The Monk Seal Genome Project cost only$15,000 thanks to the Johns Hopkins’ team’s collaboration with biotech companies developing state of the art methods (10X Genomics and Bionano Genomics).  Technological advances and skilled collaborators are making genomic sequencing more accessible than ever for non-model species (species uncommon in genetic research) like the Hawaiian monk seal.

Visit Dr. Scott’s website for more:

http://www.hopkinsmedicine.org/profiles/results/directory/profile/5985613/alan-scott

What’s next?

Now that we have the full sequence of one monk seal’s entire genome, we can start to develop new tools to  study monk seal populations.  We will determine what parts of the genome are highly variable and make good markers for things like genetic fingerprinting and parenting tests, and what parts of the genome are associated with traits of interest to study seal adaptations, or associated with health issues or disease susceptibility.  Once specific parts of the genome are identified, then larger, population-level studies can be conducted to understand the evolutionary history, local adaptation, relationships, and health of Hawaii’s monk seals.

Two young monk seals rest on the beach. We hope for a bright future for recovery of the Hawaiian monk seal population.