PIFSC RSS Feed- An error has occurred; the feed is probably down. Try again later.
Monthly Archives: July 2017
Eavesdropping on the ocean
A day in the life of a cetacean acoustician By Shannon Coates and Rachel Holton HICEAS Lead Acoustician and PIFSC Young Scientist Opportunity Intern Early mornings–late evenings–listening some of the world’s most majestic marine mammals… welcome to the life of … Continue reading
Posted in Protected Species
Tagged #HICEAS2017, #PacIsCetaceans, acoustic, Cetacean Research Program, cetaceans, DASBR, dolphins, HICEAS, hydrophone, NMFS, NOAA, Oscar Elton Sette, passive acoustics, PIFSC, Protected Species, PSD, sonobuoy, whales
Comments Off on Eavesdropping on the ocean
Benny and the Genes
By Stacie Robinson What does “aaaaaaaaaaggaattgtgaagactatat” mean to you? To the scientists of NOAA’s Hawaiian Monk Seal Research Program, it means the beginning of a new era of conservation research that will help them better understand this unique Hawaiian species … Continue reading
Posted in Protected Species
Tagged genes, genome, Hawaii, Hawaiian monk seal, NMFS, NOAA, PIFSC, Protected Species
Comments Off on Benny and the Genes
Made ya look!
By Rachel Holton PIFSC Young Scientist Opportunity Intern Visual observers are vital to locating cetaceans (whales and dolphins) during the ongoing Hawaiian Islands Cetacean and Ecosystem Assessment Survey (HICEAS). The role of an observer is to scan the surface of … Continue reading
Posted in Protected Species
Tagged #HICEAS2017, #PacIsCetaceans, Cetacean Research Program, cetaceans, dolphins, HICEAS, NMFS, NOAA, Oscar Elton Sette, PIFSC, Protected Species, PSD, visual observations, whales
Comments Off on Made ya look!
This is the end, beautiful friend, the end
by Molly Timmers After three days of travel across space and time, we arrived in Dili, the capital of Timor-Leste. This country is located about an hour’s flight northwest from Darwin, Australia across the Timor Sea. It shares its border … Continue reading
Posted in coral reef ecosystem
Tagged biodiversity, Coral Reef Ecosystem Program, coral reefs, Coral Triangle, CREP, Dili, MAF, Timor-Leste, Timor-Leste’s Ministry of Agriculture and Fisheries, U.S. Agency for International Development, USAID
Comments Off on This is the end, beautiful friend, the end
READY, SET, LOAD!
What does it take to prepare for a 187-day research mission? By Rachel Holton PIFSC Young Scientist Opportunity Intern The 2017 Hawaiian Islands Cetacean and Ecosystem Assessment Survey (HICEAS, pronounced “high-seas”) is a 187-day survey for cetaceans (whales and dolphins) … Continue reading
Posted in Protected Species
Tagged #HICEAS2017, #PacIsCetaceans, Cetacean Research Program, cetaceans, dolphins, HICEAS, NMFS, NOAA, Oscar Elton Sette, passive acoustics, PIFSC, Protected Species, PSD, visual observations, whales
Comments Off on READY, SET, LOAD!
Philippines-U.S. Exchange Knowledge in Marine Resource Management
by Megan Moews-Asher What makes a successful exchange span from across an agency to across nations? The people! Recently, a group of high-level and expert scientists, managers, policymakers, and law enforcement officials from the Philippines and U.S. came together in … Continue reading
Posted in coral reef ecosystem
Tagged BFAR, DA-BFAR, DENR-BMB, Department of Environment and Natural Resources Biodiversity Management Bureau, EBFM, Ecosystem-Based Fisheries Management, marine resource management, Office of Law Enforcement, OLE, Pacific Islands Regional Office, peer exchange, Philippines, Philippines Department of Agriculture’s Bureau of Fisheries and Aquatic Resources, PIRO, State of Hawaii’s Department of Land and Natural Resources, U.S. Coast Guard, USAID, Western Pacific Regional Fishery Management Council
Comments Off on Philippines-U.S. Exchange Knowledge in Marine Resource Management
NOAA Pacific Islands Fisheries Science Center Blog 