Eavesdropping on the ocean

A day in the life of a cetacean acoustician

By Shannon Coates and Rachel Holton

Early mornings–late evenings–listening some of the world’s most majestic marine mammals… welcome to the life of an acoustician at sea. Using a unique set of tools, we eavesdrop on animals below the ocean’s surface. With at least 25 species of cetaceans (whales and dolphins) in Hawaii, the variety of sounds is incredible. Some of those sounds are easy for us to hear and identify, but others are a challenge.

Dolphins and other toothed whale species (e.g., sperm whale, beaked whale) produce a variety of mid- (2 – 20 kHz) to high- (> 20 kHz) frequency echolocation clicks and whistles (call types). Many of the calls are outside the human hearing range (inaudible to the human ear). The highest frequencies most young adults can hear are around 15 kHz. A dog training whistle makes sounds between 25 and 55 kHz. Some dolphin clicks are as high as 115 to 130 kHz. Can you believe there are animals out there making sounds that high?

A spectrogram, or visual image, of echolocation clicks and whistles produced by our priority species, the false killer whale.

Acousticians aboard the NOAA Ship Oscar Elton Sette for the 2017 Hawaiian Islands Cetacean and Ecosystem Assessment Survey (HICEAS) spent the better part of two months prepping for this voyage before departing, including designing and building a towed array hydrophone system that can detect all call types from 1 to 250 kHz. We also set up and tested fancy customized software to record the acoustic data and track dolphin sounds. The towed array system is a series of six hydrophones towed 300 meters behind the ship. The unique spacing between each hydrophone allows us to track and localize the echolocation clicks and whistles in real time to determine how far away the whales or dolphins are from the ship. After an echolocation click or whistle is emitted from the animal, it hits, and bounces off, each hydrophone. Based on the time that signal arrives at each hydrophone, our fancy software can calculate the location of the animal. Pretty cool, right?

Acoustician Erik Norris and NOAA Teacher at Sea Staci DeSchryver hard at work deploying the towed array system off the stern (back) of the boat for nighttime eavesdropping. Photo credit: NOAA Fisheries/Amanda Bradford

Acousticians Jennifer Keating (Lead for and Erik Norris in action tracking a group of false killer whales. Photo credit: NOAA Fisheries/Amanda Bradford

Customized software called PAMGUARD is used to track echolocation clicks. The top image shows the time and bearing angle to each dolphin click as the animal moves from the bow to the stern of the ship (bearing angle 45 to 180 degrees). The lower image shows those same calculated angles on a map allowing us to measure the distance from the ship to the dolphins. The red star is the location of the group. When we’re traveling in a straight line, we can’t tell if that group is on the left or the right side of our track.

05_sonobuoy.jpg

NOAA Teacher at Sea Staci DeSchryver deploying a sonobuoy before our evening CTD station. Photo credit: NOAA Fisheries/Amanda Bradford

In contrast to dolphins, baleen whales produce low-frequency calls (10 Hz – 1 kHz). Our towed hydrophone array system isn’t built to listen to these low frequencies. Instead, we use a different tool–the sonobuoy–that is designed to detect lower frequencies. Sonobuoys are deployed from the ship and drift with a compass and directional hydrophone 30 meters below the surface. The data are then transmitted over a VHF radio signal to our lab on the ship, and we can track the location of the whales. Sonobuoys are challenging to use when we are moving along at 10 knots during a normal survey day, but when we stop at our evening CTD stations, we have a unique opportunity to listen in for a couple of hours, and hope we are lucky enough to detect baleen whales.

The last piece of equipment in our magical bag of whale-tracking tricks is the Drifting Acoustic Spar Buoy Recorder (DASBR). DASBRs are deployed from the ship to drift on the ocean current for several weeks at a time. They consist of two hydrophones, 10 m apart, connected to a small recorder at the bottom of the buoy. DASBRs are tracked with satellite transmitters to be recovered later during our survey. By using this technique, we can cover more survey ground, detect animals long after we leave an area, and hopefully find animals that usually shy away from passing ships.

DASBR

The HICEAS 2017 Acoustic team deploying a DASBR off the western coast of Maui. Photo credit: NOAA Fisheries/Staci DeSchryver

As you can see, there is never a dull moment for the HICEAS 2017 Acoustic Team. We are continuously monitoring every dolphin and whale group we find in hopes that our efforts will provide the resources needed for management of the various populations surrounding the Hawaiian Islands.

#FieldWorkWin! Jennifer Keating and Shannon Coates feel proud after fixing the noise gremlins in the towed array system. Photo credit: NOAA Fisheries/Amanda Bradford

For more information on HICEAS 2017, check out our website!

Posted in Protected Species | Tagged , , , , , , , , , , , , , , , ,

Benny and the Genes

By Stacie Robinson

What does “aaaaaaaaaaggaattgtgaagactatat” mean to you?

To the scientists of NOAA’s Hawaiian Monk Seal Research Program, it means the beginning of  a new era of conservation research that will help them better understand this unique Hawaiian species and aid in its recovery.  C, g, t, and a are the basic components of DNA, and that string represents the first tiny bit of the recently-sequenced Hawaiian monk seal genome.  Think of it as the first words of the book-of-the-monk-seal being translated for the first time.

This image shows just the beginning of the first full genome sequence of a Hawaiian monk seal. Now posted on NCBI Genbank at https://www.ncbi.nlm.nih.gov/genome/annotation_euk/Neomonachus_schauinslandi/100/.

What does a genome sequence mean to monk seals?

A lot!  A species genome is basically an organism’s complete set of genetic instructions.  It contains all of the information needed to build and maintain that organism.

With just 1,400 animals left, the Hawaiian monk seal is one of the world’s most endangered marine mammals.  To help recover the monk seal population, it’s important for scientists to understand its long-term evolutionary history as well as its current structure, health issues, and breeding biology.  Because monk seals have had a long history of population ups and downs, they are left with low genetic diversity.  So, classical genetics methods often yield inconclusive results.  The full genome sequence gives greater resolution to develop new tools and answer more questions.

A young Hawaiian monk seal swims along the reef.

The monk seal genome sequence will no doubt lead to greater understanding of the evolution of the world’s only tropical true seal.  It will help reveal the relationships between individuals to understand the population’s pedigree (how each seal is related to every other seal) and breeding biology.  It will lead to better understanding of variation throughout the population and localized adaptations for specific environments.  It will even help identify genetic factors associated with disease susceptibility or other health issues.

A mother monk seal basks on the sand with her pup. Genomics data will help to study familial relationships, pedigrees, and much more.

Who’s genome is it?

The first monk seal whose genome was sequenced was RE74, popularly known as “Benny,” a fifteen year old male who frequents beaches on Oahu’s west side.  As 1 of just about 300 animals in the main Hawaiian Islands, Benny represents the hopeful future of this species making a comeback and coexisting with the growing human population on the islands.  But, Benny also represents the challenges of coexistence: he has had several encounters with fishing gear, twice requiring open-gut surgery to remove large hooks.  The one upside to Benny’s frequent captures and veterinary treatments is that geneticistshad plenty of opportunities to get fresh blood samples!  Maybe they’ll even find the gene that codes for the dangerous love of fish hooks! (OK – probably not, that’s almost certainly a very complex trait from just as much nurture as nature!)

This is Benny (RE74), just before release with a satellite tracking tag after he’d undergone surgery to remove a fish hook. While he was being treated, several samples were collected – some of which led to the first monk seal genome sequence.

What made it possible? 

Collaboration! Technology!  The monk seal genome was sequenced and annotated by Drs. Alan Scott and David Mohr and their collaborators at Johns Hopkins University and partnering companies.  While you may have heard about the many years and many millions of dollars involved in The Human Genome Project, The Monk Seal Genome Project cost only$15,000 thanks to the Johns Hopkins’ team’s collaboration with biotech companies developing state of the art methods (10X Genomics and Bionano Genomics).  Technological advances and skilled collaborators are making genomic sequencing more accessible than ever for non-model species (species uncommon in genetic research) like the Hawaiian monk seal.

Visit Dr. Scott’s website for more:

http://www.hopkinsmedicine.org/profiles/results/directory/profile/5985613/alan-scott

What’s next?

Now that we have the full sequence of one monk seal’s entire genome, we can start to develop new tools to  study monk seal populations.  We will determine what parts of the genome are highly variable and make good markers for things like genetic fingerprinting and parenting tests, and what parts of the genome are associated with traits of interest to study seal adaptations, or associated with health issues or disease susceptibility.  Once specific parts of the genome are identified, then larger, population-level studies can be conducted to understand the evolutionary history, local adaptation, relationships, and health of Hawaii’s monk seals.

Two young monk seals rest on the beach. We hope for a bright future for recovery of the Hawaiian monk seal population.

 

Posted in Protected Species | Tagged , , , , , , ,

Made ya look!

By Rachel Holton

Visual observers are vital to locating cetaceans (whales and dolphins) during the ongoing Hawaiian Islands Cetacean and Ecosystem Assessment Survey (HICEAS). The role of an observer is to scan the surface of the water using 25-powered binoculars that we call “big eyes.” From the big eyes mounted on the ship’s flying bridge, the observers can see up to 7.5 nautical miles from the ship, although they usually focus within 3 nautical miles, where cetacean sightings are less likely to be missed. A right- and left-side observer each scans 90 degrees, looking for cetaceans from the ship’s beam to its bow, a motion that is repeated multiple times over a 40-minute shift. The center observer watches ahead of the ship generally without binoculars and records data. Altogether, the observer team is scanning the water 180 degrees ahead of the ship for animals, suspicious splashes, blows, or flocks of birds that might reveal cetaceans feeding below.

HICEAS Senior Observer Ernesto Vázquez uses “big eye” binoculars to search for cetaceans. Photo credit: NOAA Fisheries/Staci DeSchryver

When the visual team spots a cetacean group, the next step is to figure out what species it is and how many individuals are in the group.  While the big eyes are the main binoculars used when searching for cetaceans, as the ship approaches a sighted group, the team switches to smaller 7-powered handheld binoculars that offer a wider field of view at closer distances. If the visual team needs another look once the ship passes the animals, the ship can be turned to pass by the group again or to collect additional information, including photographs or skin samples. When weather conditions and animal behavior allow, a small boat may be launched from the ship to approach the animals for more detailed data collection.

HICEAS Senior Observer Paula Olson keeps an eye on a group of sighted cetaceans. Photo credit: NOAA Fisheries/Staci DeSchryver

When asked how visual observers prepare for a survey of this size and importance, visual observer Andrea Bendlin responds with, “a LOT of experience.” A visual observer needs to be able to distinguish between a white cap and a splash from a dolphin. “When it’s windy, which is most of the time, you see a lot of white caps, but did you just see a white cap go backwards? That would be the splash from a dolphin instead,” explains Andrea. Andrea describes how there might also be a slight glare or sparkle on the water that could be the back of an animal and be easily overlooked.

Once distant splashes that caught an observer’s eye, these melon-headed whales come into full view when approached by the ship during HICEAS. Photo taken under research permit by NOAA Fisheries/Adam Ü

When the visual team sees a group of cetaceans, each person is required to make an estimate of the number of individuals in the group. The team members write their estimates in their own private notebooks and don’t talk about their estimates with their teammates. The numbers are kept a secret so that individual observers don’t change their tendencies in how they estimate group size over time. Early on, the observers are taught how to count cetaceans. Many observers have been calibrated against aerial images of cetacean groups, where the number seen in the aerial image is compared to the estimate from each observer in order to determine the amount of error in the estimate. Since observers usually underestimate how many cetaceans they see in a group, the calibration results can be used to make the group size estimates more accurate.

HICEAS Observers Amy Van Cise, Andrea Bendlin, and Allan Ligon independently record group size estimates after a cetacean sighting. Photo credit: NOAA Fisheries/Staci DeSchryver

Although sightings are made by the visual team, an acoustic team is simultaneously listening and independently detecting cetaceans that are vocalizing underwater. Once a sighting has been made, communication between the two teams opens up, and the acoustics team is often able to help the visual team keep track of sighted cetaceans that are no longer at the surface. However, the acoustics team does a lot more than provide support to the visual observers. To learn more about the role of acoustics during HICEAS, stay tuned for our next blog post.

Until then, you can keep up with our high seas adventures on the HICEAS website!

Posted in Protected Species | Tagged , , , , , , , , , , , ,

This is the end, beautiful friend, the end

by Molly Timmers

After three days of travel across space and time, we arrived in Dili, the capital of Timor-Leste. This country is located about an hour’s flight northwest from Darwin, Australia across the Timor Sea. It shares its border with Indonesia, which occupies the western half of the island of Timor. Unbeknownst to most, Timor-Leste only just recently became a sovereign nation after years of struggle and resistance to an Indonesian occupation. Having gained its independence in 2002, this country is one of the newest countries in the world. It is also one of the most biologically diverse countries in the world for coral reefs.

atauro1

Reef at Atauro Island, Timor-Leste (Photo: NOAA Fisheries/Molly Timmers).

Timor-Leste resides within the Coral Triangle, a region known as the center of marine biodiversity. As a result of its geographical location between the Pacific and Indian Oceans and its geological history, the Coral Triangle has the highest coral and fish diversity in the world.  It hosts 76% (605) of the world’s coral species (798) and 37% (2228) of known coral reef fish species (6000). This incredibly diverse region includes Indonesia, Papua New Guinea, Malaysia, Philippines, the Solomon Islands, and of course, Timor-Leste.

CTI

Map of the six countries of the Coral region. Solid line shows scientific boundary of the Coral Triangle (Veron et al., 2009). Dashed line shows the Exclusive Economic Zones of the six countries (Image courtesy of Coral Triangle Secretariat).

As a new country, Timor-Leste began working toward developing management strategies to protect and conserve their coral reefs and the animals that live within. However, they found it challenging to proceed because scientific information about their nearshore coastal resources was limited. Thus, in 2011, the Government of Timor-Leste’s Ministry of Agriculture and Fisheries (MAF) requested assistance from the U.S. Agency for International Development (USAID) and NOAA to support them in addressing the following 5 questions:

  • Where are Timor-Leste’s nearshore marine resources?
  • What are Timor-Leste’s nearshore resources?
  • How are coastal resources changing over time?
  • What are the threats causing those changes?
  • What approaches are needed to help manage and conserve nearshore resources over the long-term?

TIMOR_COVER_image As a result, USAID requested the assistance of NOAA’s Coral Reef Ecosystem Program (CREP) of the Pacific Islands Fisheries Science Center. With over 15 years of experience mapping and monitoring the coral reef ecosystems and their associated threats across U.S. Pacific coral reefs, CREP agreed to assist Timor-Leste in their efforts to address these questions by conducting baseline surveys over the period 2012 to 2016 under the partnership agreement between MAF, USAID, and NOAA. Last month, we returned to Timor-Leste to conclude this partnership by delivering the Final Report to our Timor-Leste partners and working with them on how to utilize the collected data to inform ecosystem-based coastal resource management planning in Timor-Leste.

On the 26th of June, we presented the Final Report produced by our program in an all-day workshop event and provided a separate training on how to use the data in a geospatial format (aka, mapping software) the following day.  The all-day workshop was held at MAF’s new conference center.  Over 70 people from 19 agencies attended, including: Estanislau Aleixo da Silva, the Minister of Agriculture and Fisheries; Ms. Karen Stanton, the U.S. Ambassador to Timor-Leste; and Jose Ramos-Horta, a 1996 Nobel Peace Prize recipient and one of Timor-Leste’s former presidents who signed the agreement for Timor-Leste to become one of the six Coral Triangle Initiative countries. The U.S. Embassy graciously provided their interpreter who translated in real-time between Tetun (the locale Timorese language) and English through wireless ear bud systems that enabled us to seamlessly share our presentations and effectively engage our audience in question and answer sessions.

Group

Photograph from the all-day workshop hosted by the Government of Timor-Leste’s Ministry of Agriculture and Fisheries (MAF), led by NOAA’s Coral Reef Ecosystem Program (NOAA CREP), and funded by the U.S. Agency for International Development (USAID). From left to right: Acacio Guterres, Director General for Fisheries (MAF); Raimundo Mau, Program Manager, Conservation International; former Timor-Leste President Jose Ramos-Horta; Estanislau Aleixo da Silva, Minister of MAF; Karen Stanton, U.S. Ambassador; Diana Putman, USAID Mission Director; Molly Timmers (NOAA CREP); Flavia da Silva (USAID); and Annette DesRochers (NOAA CREP).

Ambassador Stanton opened the workshop and Minister da Silva followed with his opening remarks. To symbolize the closure of this 5-year partnership, we presented copies of the Final Report and detailed scientific maps to Ambassador Stanton who then proceeded to hand them to the Minister.  Once the symbolic hand-off was complete, the workshop commenced.

Map presentation

U.S. Ambassador Karen Stanton presents the map posters prepared by the NOAA Coral Reef Ecosystem Program to Estanislau Aleixo da Silva, the Minister of Agriculture and Fisheries.

We started with a series of presentations on the project background and key findings. This was followed by a nearly two-hour question and answer session and a delicious late lunch due to the high-level of engagement by the participants. After lunch, more detailed presentations ensued. We framed our presentations around MAF’s 5 original questions and shared in more detail the work that we did to try and answer their questions. To make this information as accessible as possible, the report and data are freely available and hosted online at NOAA’s Coral Reef Information System. Once we finished with all we had to share, we had another question and answer session followed by closing remarks made by Diana Putman, the USAID Timor-Leste Mission Director, and Acacio Guterres, Director General for Fisheries (MAF).

The following day we conducted a hands-on training for MAF employees on how to use the data we produced for MAF. They learned how to access and convert the survey data so it could be displayed in mapping software with other spatial data, and how they could “ask questions” of the data using the mapping tools. Participants learned how to work with data in new ways that they previously didn’t know were possible.

For our final day, we spent the afternoon meeting with our partners answering last minute questions; this officially brought an end to our partnership. It is with such sweet sorrow that we see this project come to an end. Many of us at CREP have spent time in Timor-Leste over the past five years helping with this project and found Timor-Leste to be a home away from home. The Timorese are a gracious, kind, and motivated people. They want to protect and conserve their coral reefs and hopefully in time, they will have the capacity themselves to establish their own long-term monitoring program just as we did 15 years ago here in the U.S. Pacific Islands. We hope the work that we’ve done and the time we’ve invested will get them started down the path towards our mutual goal to protect and conserve coral reefs ecosystems.

TIMOR_reef_K.Lino

Shallow reef along the west side of Atauro Island, Timor-Leste (Photo: NOAA Fisheries/Kevin Lino).

Posted in coral reef ecosystem | Tagged , , , , , , , , , ,

READY, SET, LOAD!

What does it take to prepare for a 187-day research mission?

By Rachel Holton

The 2017 Hawaiian Islands Cetacean and Ecosystem Assessment Survey (HICEAS, pronounced “high-seas”) is a 187-day survey for cetaceans (whales and dolphins) and seabirds within the U.S. waters of the Hawaiian Islands. The goals of this project are to estimate how many cetaceans are in Hawaii, examine their population structure, and understand their habitat.

Early morning hustle and bustle getting the NOAA ship Oscar Elton Sette ready for HICEAS. Photo credit: NOAA Fisheries/Rachel Holton

HICEAS is large, multi-disciplinary effort that includes several types of data collection, which means that in order for things to run smoothly there has to be a well thought out plan. Teams from the Pacific Islands and Southwest Fisheries Science Centers have been meeting and coordinating for several months to design the survey and develop data collection protocols.

A crane loads heavy gear, here the net reel for retrieving an acoustic mooring, onto the Sette. Photo credit: NOAA Fisheries/Rachel Holton

Two NOAA Ships, the Oscar Elton Sette and the Reuben Lasker, will house a team of over 25 scientists to collect data during HICEAS. The Sette (homeport: Pearl Harbor, Oahu) is used for a variety of projects near the Hawaiian Islands, which means that it is constantly being rearranged. Before the team can get underway, the ship needs to be equipped with all the right gizmos and gadgets relating to the HICEAS project.

The “wet lab” space on the Sette awaits organization, so that activities ranging from biopsy sample processing to hexacopter maintenance can occur seamlessly. Photo credit: NOAA Fisheries/Rachel Holton

As HICEAS approached, it was all hands on deck to load the Sette. A loading schedule was created to allow enough time for different groups to load the ship. For example, the heavy equipment was scheduled for 9 a.m., and food delivery was scheduled for 10:30 a.m. This was to avoid a bottleneck of people and materials and prevent smashing the food deliveries with hefty gear!

HICEAS Chief Scientist, Erin Oleson (front right) and team members Kym Yano, Marie Hill, and Amanda Bradford (left to right) focus intently on setting up the big-eye binoculars that will be used to search for cetaceans during the survey. Photo credit: NOAA Fisheries/Rachel Holton

Cranes are used to load four pairs of giant (“big-eye”) binoculars, the winch for the towed hydrophone array, crates of equipment, small boats, and other heavy gear, but a lot of packing and loading is done manually by the team of scientists preparing to live aboard the ship.  The equipment must be cleaned and greased to ensure that everything will work efficiently for the duration of the cruise. Planning and packing for a cruise of this size takes a lot of preparation.

HICEAS Lead Acoustician, Jennifer Keating, sets up the acoustics “cave” on the Sette to receive whale and dolphin sounds from the deep. Photo credit: NOAA Fisheries/Rachel Holton

The Sette is now underway for HICEAS. While everyone gets their sea legs and gets back into the groove of ship life, the team tackles another aspect of getting large project underway- tackling equipment and software gremlins. Most of those sneaky noises, software bugs, and missing duct tape mysteries have now been worked out, and the preparations begin to set up the Lasker in San Diego before their journey to Hawaii to join the HICEAS mission.

To learn more more about our high seas adventures, check out the HICEAS website!

Posted in Protected Species | Tagged , , , , , , , , , , , ,

Philippines-U.S. Exchange Knowledge in Marine Resource Management

by Megan Moews-Asher
1.Sardines_M.Moews-Asher

A school of sardines above a coral reef in Cebu, Philippines (Photo: NOAA Fisheries/Megan Moews-Asher).

What makes a successful exchange span from across an agency to across nations? The people! Recently, a group of high-level and expert scientists, managers, policymakers, and law enforcement officials from the Philippines and U.S. came together in a government-to-government peer exchange in Honolulu. They discussed fisheries and marine resource management, science, and enforcement between the two countries.

This effort—supported by the U.S. Agency for International Development (USAID) and several offices within NOAA Fisheries—was a success because of each and every individual (and there were many) who played a part. According to both PIFSC Director Mike Seki and Regional Administrator Mike Tosatto from the Pacific Islands Regional Office (PIRO), the exchange exceeded their expectations. Administrator Tosatto, Director Seki, and Office of Law Enforcement’s (OLE) Assistant Director Bill Pickering stated that they and many of their staff learned a lot through the exchange and were thankful to all who participated and made it such a success. In addition, Director Seki said that, “it was pretty impressive how it rolled out and that’s only through the engagement [of all parties], so I appreciate that.”

2.Group_2017.06.26

Group picture of particpants on June 26 (Day 1) of the Peer Exchange, including Philippines Undersecretary for Fisheries and Director of DA-BFAR Eduardo Gongona, Philippines Director of DENR-BMB Mundita Lim, and NOAA PIRO Regional Administrator Mike Tosatto, PIFSC Director Mike Seki, and Office of Law Enforcement Assistant Director Bill Pickering (Photo: NOAA Fisheries).

3.Sunset_Moalboal

Sunset at Moalboal, Philippines (Photo: NOAA Fisheries/Megan Moews-Asher).

It all started a few years ago with a vision. USAID’s Rebecca Guieb and Dr. Rusty Brainard of NOAA discussed the need for a scientific exchange between fisheries scientists from the Philippines and United States. Over time, the concept evolved into a much broader sharing of expertise and information that brought together the Philippines Department of Agriculture’s Bureau of Fisheries and Aquatic Resources (DA-BFAR), the Department of Environment and Natural Resources Biodiversity Management Bureau (DENR-BMB), several NOAA Fisheries offices (PIFSC, PIRO, OLE, and General Counsel), as well as the U.S. Coast Guard, State of Hawaii’s Department of Land and Natural Resources, the Western Pacific Regional Fishery Management Council, and other partners.

6.OLE_Vessel Inspection

Inspection of longline fishing vessel. Tour and discussion led by NOAA Office of Law Enforcement’s Joe Scarpa at Pier 38 (Photo: NOAA Fisheries).

In an open and honest sharing of information, participants gave their valuable time as part of the “Ecosystem-based Fisheries Management and Conservation: A Partnership in Governance, Management, Science and Enforcement” Peer Exchange that included what the different countries and agencies are currently doing to manage fisheries and conserve biodiversity, the challenges they face, and some of the key lessons-learned over the years. As stated by DENR-BMB Director Dr. Mundita Lim, “the exchange provided an insight of interconnectivity among disciplines.”

As a result of everyone’s candidness and genuine desire to make the exchange a success, the dialogue led to thoughtful and engaging presentations and discussions, new partnerships, improved collaborations, and future plans. The surprise? On Friday, June 30, the Philippines Undersecretary for Fisheries and DA-BFAR Director Commodore Eduardo Gongona and DENR-BMB Director Lim signed a “Declaration of Commitment and Action Plan for the Management of Shared Resources.” The declaration is an unprecedented effort between their two agencies to increase collaboration in the management and protection of their shared marine resources and ocean ecosystems!

7.Declaration

Declaration signing between the Philippines Director of DENR-BMB Mundita Lim and Philippines Undersecretary for Fisheries and Director of DA-BFAR Eduardo Gongona (Photo: NOAA Fisheries).

Throughout the exchange, Undersecretary Gongona and Director Lim discussed ways in which their bureaus can work together in the future. It is anticipated that this signing will lead to a memorandum of understanding between the two bureaus in the coming months. This is an exciting prospect for the Philippines, where marine resources are some of the most highly diverse in the world, where vast fisheries and marine resources face a multitude of threats, and of utmost importance, where people depend on these resources for their food security and livelihoods.

8.UFA Tour

Inspection of longline fishing vessel. Tour and discussion led by NOAA Office of Law Enforcement’s Joe Scarpa at Pier 38 (Photo: NOAA Fisheries).

Director Seki explained, “many of the Pacific Rim countries have very similar problems.  The sense of food security and conservation is pretty much ubiquitous throughout all of our countries that rely on marine resources and it is on us as scientists and managers to make sure that the resources are there tomorrow.” To add to this, Regional Administrator Tosatto stated, “it really was striking to see how we’re dealing with common problems coming from very different ground truths and yet we’re still solving problems in much the same way, and I think we can help each other.”

Special thanks to ALL involved, but in particular, to DA-BFAR Undersecretary Eduardo Gongona, DENR-BMB Director Mundita Lim, Mike Tosatto, Mike Seki, and Bill Pickering for their time, support and leadership. In addition, to sum up the significance of the exchange and the importance of working together toward sustainability and protection of our fisheries and marine resources, a few words from Bill Pickering, “It’s a trifecta, you have to have all three sides of the triangle [science, management, enforcement] in order to make it work. I don’t think any side is more important than the other because if one of them is missing, whether it be the science, the regulations, or the enforcement part, the whole thing falls apart.” Further addressing the Peer Exchange participants, he stated, “you’re proof of that, from listening to everything you all said.”

For more information:
Posted in coral reef ecosystem | Tagged , , , , , , , , , , , , , , , , ,